ID: 913532620_913532631

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 913532620 913532631
Species Human (GRCh38) Human (GRCh38)
Location 1:119743428-119743450 1:119743479-119743501
Sequence CCAGCCCAGCTGCAGCAAAACCT TGGACCTGCCCCAGTCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 28, 4: 312} {0: 1, 1: 0, 2: 1, 3: 13, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!