ID: 913532621_913532634

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 913532621 913532634
Species Human (GRCh38) Human (GRCh38)
Location 1:119743432-119743454 1:119743485-119743507
Sequence CCCAGCTGCAGCAAAACCTACAA TGCCCCAGTCAGCTGGGGCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 38, 4: 322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!