ID: 913539209_913539218

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 913539209 913539218
Species Human (GRCh38) Human (GRCh38)
Location 1:119802922-119802944 1:119802956-119802978
Sequence CCCTCTTCTCTCCATTTCACCAG TCTCTTCATAGTGCCCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 623} {0: 1, 1: 0, 2: 7, 3: 96, 4: 1890}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!