ID: 913558063_913558065

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 913558063 913558065
Species Human (GRCh38) Human (GRCh38)
Location 1:119989108-119989130 1:119989141-119989163
Sequence CCAAACTGTCTAGGCTCAACTCT ATGCAATAGCTGAGTGAATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 167} {0: 1, 1: 0, 2: 1, 3: 16, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!