ID: 913564910_913564913

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 913564910 913564913
Species Human (GRCh38) Human (GRCh38)
Location 1:120063432-120063454 1:120063449-120063471
Sequence CCTATGCATTCTAACATCTCAGG CTCAGGTAACATTCTAATGGAGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 0, 3: 16, 4: 125} {0: 5, 1: 0, 2: 0, 3: 6, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!