ID: 913597742_913597746

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 913597742 913597746
Species Human (GRCh38) Human (GRCh38)
Location 1:120394454-120394476 1:120394504-120394526
Sequence CCTTAAAATATTGCTTGGGTTGC CCTACAGCCATTAGCCTCAGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 8, 4: 131} {0: 5, 1: 0, 2: 0, 3: 4, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!