ID: 913609939_913609945

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 913609939 913609945
Species Human (GRCh38) Human (GRCh38)
Location 1:120501218-120501240 1:120501245-120501267
Sequence CCAGCTTGTGCTGCAGTCTGACC AGAGGCAAGGCCCACTGAGATGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 3, 3: 25, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!