ID: 913611341_913611347

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 913611341 913611347
Species Human (GRCh38) Human (GRCh38)
Location 1:120512545-120512567 1:120512567-120512589
Sequence CCAGCTCATCAGACAGGAAAGAG GGTGCTGCTGGGAGAGCGGTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 25, 4: 191} {0: 2, 1: 0, 2: 3, 3: 21, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!