ID: 913686976_913686985 |
View in Genome Browser |
Spacer: 20 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 913686976 | 913686985 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 1:121241444-121241466 | 1:121241487-121241509 |
| Sequence | CCCTTTACAGAAGTTCATTATGA | CATTGTAAAGGGAGTAGGGAAGG |
| Strand | - | + |
| Off-target summary | {0: 4, 1: 0, 2: 1, 3: 20, 4: 237} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||