ID: 913688727_913688732

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 913688727 913688732
Species Human (GRCh38) Human (GRCh38)
Location 1:121258144-121258166 1:121258163-121258185
Sequence CCTTCTGAAATTGCCTCCTTGTG TGTGGCCTGAAATCCTTTCTGGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 1, 3: 15, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!