ID: 913706912_913706920

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 913706912 913706920
Species Human (GRCh38) Human (GRCh38)
Location 1:121434516-121434538 1:121434548-121434570
Sequence CCTTAGGTACCAGCACAGCCACA CAGAGAACCAAGTGGGGTCTTGG
Strand - +
Off-target summary {0: 20, 1: 95, 2: 164, 3: 271, 4: 391} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!