ID: 913710063_913710066

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 913710063 913710066
Species Human (GRCh38) Human (GRCh38)
Location 1:121473789-121473811 1:121473810-121473832
Sequence CCTAAATCATCTTTTTCAAGTTC TCAAGGGCCCACAAATATCTAGG
Strand - +
Off-target summary {0: 4, 1: 233, 2: 1871, 3: 2023, 4: 1705} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!