ID: 913957636_913957639

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 913957636 913957639
Species Human (GRCh38) Human (GRCh38)
Location 1:143319332-143319354 1:143319362-143319384
Sequence CCAACGTTGGGGCAGGGCAAATC GACACCTCCAAGTCCATCTCTGG
Strand - +
Off-target summary {0: 18, 1: 11, 2: 3, 3: 5, 4: 67} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!