ID: 913995948_913995954

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 913995948 913995954
Species Human (GRCh38) Human (GRCh38)
Location 1:143652107-143652129 1:143652147-143652169
Sequence CCCGCTTGTGGGGAAATCGCAGA GCGGTGGACTAGCCTCATCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 2, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!