ID: 914038836_914038840

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 914038836 914038840
Species Human (GRCh38) Human (GRCh38)
Location 1:144029084-144029106 1:144029115-144029137
Sequence CCCTTTACAGAAGTTCATTATGA GGATGAAATCAACATTGTAAAGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 0, 3: 30, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!