ID: 914054399_914054406

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 914054399 914054406
Species Human (GRCh38) Human (GRCh38)
Location 1:144158090-144158112 1:144158131-144158153
Sequence CCTGGTTGTGCCTTGCCAGGAGC GAGTGTCATGAGCGCAGCGGTGG
Strand - +
Off-target summary {0: 7, 1: 0, 2: 3, 3: 11, 4: 127} {0: 4, 1: 2, 2: 1, 3: 3, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!