ID: 914086884_914086890

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 914086884 914086890
Species Human (GRCh38) Human (GRCh38)
Location 1:144461668-144461690 1:144461704-144461726
Sequence CCAAGGCGCAGGCGCAGCGGGGC GGCCGCCTCTGCGGCACAGCGGG
Strand - +
Off-target summary {0: 4, 1: 2, 2: 3, 3: 25, 4: 237} {0: 2, 1: 3, 2: 0, 3: 12, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!