ID: 914116530_914116536

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 914116530 914116536
Species Human (GRCh38) Human (GRCh38)
Location 1:144746379-144746401 1:144746426-144746448
Sequence CCTGGCTTGAACAATGACAACAT TCCAGAGGAAGGTGGCTCCAGGG
Strand - +
Off-target summary {0: 7, 1: 0, 2: 1, 3: 20, 4: 229} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!