ID: 914150609_914150614

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 914150609 914150614
Species Human (GRCh38) Human (GRCh38)
Location 1:145038802-145038824 1:145038818-145038840
Sequence CCTTCCCTACTCCCTTTACAATG TACAATGTTGATTTCATCCTTGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 2, 3: 25, 4: 295} {0: 4, 1: 0, 2: 1, 3: 15, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!