ID: 914176588_914176601

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 914176588 914176601
Species Human (GRCh38) Human (GRCh38)
Location 1:145284423-145284445 1:145284470-145284492
Sequence CCGGGTGAGCTAGGGCTCCGAAG GGTAAGGGCACCGCCCGTTTAGG
Strand - +
Off-target summary {0: 7, 1: 0, 2: 2, 3: 11, 4: 74} {0: 5, 1: 2, 2: 0, 3: 2, 4: 20}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!