ID: 914199800_914199809

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 914199800 914199809
Species Human (GRCh38) Human (GRCh38)
Location 1:145474927-145474949 1:145474948-145474970
Sequence CCAGTAAATCCAGGCCCATCCTG TGGGGATAGGATATCTCTCTAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 140} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!