ID: 914199806_914199812

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 914199806 914199812
Species Human (GRCh38) Human (GRCh38)
Location 1:145474941-145474963 1:145474976-145474998
Sequence CCCATCCTGGGGATAGGATATCT TATTAACAATGAAAAAATTAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 11, 4: 84} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!