ID: 914203449_914203460

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 914203449 914203460
Species Human (GRCh38) Human (GRCh38)
Location 1:145506155-145506177 1:145506182-145506204
Sequence CCCGCCAAGCCCACGCCCACCCT TCCGGCTGGTCTGCAAGCGCCGG
Strand - +
Off-target summary {0: 7, 1: 426, 2: 492, 3: 456, 4: 711} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!