ID: 914205017_914205023

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 914205017 914205023
Species Human (GRCh38) Human (GRCh38)
Location 1:145519197-145519219 1:145519231-145519253
Sequence CCCTTGAAGTTGTTAGACATTCA CTGAATGAGCTTTTGGTAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 261} {0: 4, 1: 0, 2: 2, 3: 7, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!