ID: 914205018_914205023

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 914205018 914205023
Species Human (GRCh38) Human (GRCh38)
Location 1:145519198-145519220 1:145519231-145519253
Sequence CCTTGAAGTTGTTAGACATTCAG CTGAATGAGCTTTTGGTAGAGGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 2, 3: 7, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!