ID: 914221843_914221846

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 914221843 914221846
Species Human (GRCh38) Human (GRCh38)
Location 1:145688608-145688630 1:145688624-145688646
Sequence CCAAGAACTGAAGGATTAGTAGA TAGTAGAAGCTTGGTGAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 195} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!