ID: 914224243_914224252

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 914224243 914224252
Species Human (GRCh38) Human (GRCh38)
Location 1:145707273-145707295 1:145707304-145707326
Sequence CCCCGGTGGCCAGCACCCTCAAG GAGCAGTTCTTACCTGGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 158} {0: 1, 1: 0, 2: 0, 3: 17, 4: 329}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!