ID: 914249012_914249020

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 914249012 914249020
Species Human (GRCh38) Human (GRCh38)
Location 1:145906773-145906795 1:145906814-145906836
Sequence CCCAGGTGCATATTCACAGCAGG TTGGTAGTCACCTGGTTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 133} {0: 1, 1: 0, 2: 1, 3: 19, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!