ID: 914254474_914254480

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 914254474 914254480
Species Human (GRCh38) Human (GRCh38)
Location 1:145950183-145950205 1:145950225-145950247
Sequence CCTTAGTTCAGATCTGCCAAGAA CAATTGCAAGAGATTTATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 115} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!