ID: 914281108_914281113

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 914281108 914281113
Species Human (GRCh38) Human (GRCh38)
Location 1:146173852-146173874 1:146173872-146173894
Sequence CCACATTTCCATTGTTACTGTTC TTCAAACATACGCATGGGGTTGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 4, 3: 22, 4: 353} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!