ID: 914284073_914284078 |
View in Genome Browser |
Spacer: 18 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 914284073 | 914284078 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 1:146206489-146206511 | 1:146206530-146206552 |
| Sequence | CCTCTTTCCTTCAAGCACAGCAG | TCTTTATCTGCAGACTTTGGGGG |
| Strand | - | + |
| Off-target summary | {0: 5, 1: 0, 2: 4, 3: 31, 4: 272} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||