ID: 914296145_914296152

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 914296145 914296152
Species Human (GRCh38) Human (GRCh38)
Location 1:146326995-146327017 1:146327021-146327043
Sequence CCCCTTATACATTCAGGCCTAGG GGTAACAACCAGTATGCTACTGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 1, 3: 5, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!