ID: 914315481_914315487

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 914315481 914315487
Species Human (GRCh38) Human (GRCh38)
Location 1:146507591-146507613 1:146507620-146507642
Sequence CCTTCAGGGCTAGATGAAGGTGT TGCTTTTTCTTCCATGGTGGGGG
Strand - +
Off-target summary No data {0: 3, 1: 2, 2: 2, 3: 29, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!