ID: 914336989_914336993

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 914336989 914336993
Species Human (GRCh38) Human (GRCh38)
Location 1:146724529-146724551 1:146724557-146724579
Sequence CCTGGGTTCCTCTGCTCAGAGAA GTGGCAGCACAGCTCATTGGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 24, 4: 290} {0: 2, 1: 0, 2: 1, 3: 15, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!