ID: 914393451_914393469

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 914393451 914393469
Species Human (GRCh38) Human (GRCh38)
Location 1:147242616-147242638 1:147242667-147242689
Sequence CCAGCGCGCAGTCGCGCGCCCCC GCGCTTGGCCGCGCGGGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 157} {0: 1, 1: 0, 2: 1, 3: 30, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!