ID: 914486015_914486019

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 914486015 914486019
Species Human (GRCh38) Human (GRCh38)
Location 1:148110411-148110433 1:148110446-148110468
Sequence CCTCTAATGAGTGAAATGTGCTG TACGAGGCCAACCTTTCAGGAGG
Strand - +
Off-target summary {0: 11, 1: 2, 2: 4, 3: 10, 4: 126} {0: 1, 1: 11, 2: 1, 3: 2, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!