ID: 914490205_914490212

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 914490205 914490212
Species Human (GRCh38) Human (GRCh38)
Location 1:148146877-148146899 1:148146905-148146927
Sequence CCTCTATGCCGACATCGACGCCA CAGGCCCTGCGCACCAGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 2, 3: 4, 4: 13} {0: 11, 1: 0, 2: 4, 3: 14, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!