ID: 914490207_914490221

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 914490207 914490221
Species Human (GRCh38) Human (GRCh38)
Location 1:148146885-148146907 1:148146931-148146953
Sequence CCGACATCGACGCCACCTGGCAG ACCCTGGGGGCAGCTCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 7, 3: 2, 4: 87} {0: 6, 1: 1, 2: 6, 3: 37, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!