ID: 914490209_914490223

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 914490209 914490223
Species Human (GRCh38) Human (GRCh38)
Location 1:148146897-148146919 1:148146932-148146954
Sequence CCACCTGGCAGGCCCTGCGCACC CCCTGGGGGCAGCTCAGCCTGGG
Strand - +
Off-target summary {0: 10, 1: 2, 2: 3, 3: 33, 4: 324} {0: 6, 1: 1, 2: 13, 3: 65, 4: 467}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!