ID: 914490214_914490225

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 914490214 914490225
Species Human (GRCh38) Human (GRCh38)
Location 1:148146909-148146931 1:148146945-148146967
Sequence CCCTGCGCACCAGGTGAGGGCGA TCAGCCTGGGCACACCCAAGAGG
Strand - +
Off-target summary {0: 10, 1: 1, 2: 0, 3: 6, 4: 90} {0: 6, 1: 4, 2: 2, 3: 10, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!