ID: 914490219_914490229

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 914490219 914490229
Species Human (GRCh38) Human (GRCh38)
Location 1:148146918-148146940 1:148146953-148146975
Sequence CCAGGTGAGGGCGACCCTGGGGG GGCACACCCAAGAGGGGACCAGG
Strand - +
Off-target summary {0: 5, 1: 3, 2: 6, 3: 24, 4: 238} {0: 4, 1: 4, 2: 2, 3: 13, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!