ID: 914490219_914490236

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 914490219 914490236
Species Human (GRCh38) Human (GRCh38)
Location 1:148146918-148146940 1:148146960-148146982
Sequence CCAGGTGAGGGCGACCCTGGGGG CCAAGAGGGGACCAGGCGGGGGG
Strand - +
Off-target summary {0: 5, 1: 3, 2: 6, 3: 24, 4: 238} {0: 2, 1: 2, 2: 6, 3: 25, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!