ID: 914501104_914501110

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 914501104 914501110
Species Human (GRCh38) Human (GRCh38)
Location 1:148247160-148247182 1:148247195-148247217
Sequence CCAGCTTCCATTTTTTTCATTTT TAGAGAGGTGTCCTATCCCCAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 8, 3: 260, 4: 2931} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!