ID: 914516150_914516154

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 914516150 914516154
Species Human (GRCh38) Human (GRCh38)
Location 1:148376384-148376406 1:148376409-148376431
Sequence CCTGTTAGGTGCAGGATTCTGTT CTCCAATGATGGGTGTCAGATGG
Strand - +
Off-target summary No data {0: 3, 1: 3, 2: 1, 3: 3, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!