ID: 914521943_914521948

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 914521943 914521948
Species Human (GRCh38) Human (GRCh38)
Location 1:148425582-148425604 1:148425615-148425637
Sequence CCGCCATGACTCCCACCAGCTTC TGCCTTCCTCTTTGATGCACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 57, 4: 494} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!