ID: 914566562_914566566

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 914566562 914566566
Species Human (GRCh38) Human (GRCh38)
Location 1:148873196-148873218 1:148873233-148873255
Sequence CCAATAACTCATGATTGAGCCTG CTTTGTGACCTAAAGATAGTGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 0, 3: 6, 4: 104} {0: 4, 1: 0, 2: 0, 3: 7, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!