ID: 914580663_914580668

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 914580663 914580668
Species Human (GRCh38) Human (GRCh38)
Location 1:149016528-149016550 1:149016550-149016572
Sequence CCAGCTTAACTCCAAACCCACAG GGTAAAGCACAAAGCAGAGATGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 13, 4: 178} {0: 2, 1: 0, 2: 1, 3: 39, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!