|
Left Crispr |
Right Crispr |
| Crispr ID |
914580677 |
914580684 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:149016638-149016660
|
1:149016670-149016692
|
| Sequence |
CCTCCTCCATCCCTGGCTCACAG |
AAAATGCAAGAGCTGTATCAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 0, 2: 12, 3: 95, 4: 752} |
{0: 2, 1: 0, 2: 1, 3: 14, 4: 237} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|