ID: 914590688_914590692

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 914590688 914590692
Species Human (GRCh38) Human (GRCh38)
Location 1:149103560-149103582 1:149103587-149103609
Sequence CCAAGGCGCAGGCGCAGCGGGGC AAGGTACATGGCCGCCTCTGCGG
Strand - +
Off-target summary {0: 4, 1: 2, 2: 3, 3: 25, 4: 237} {0: 2, 1: 0, 2: 0, 3: 8, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!