ID: 914647736_914647738

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 914647736 914647738
Species Human (GRCh38) Human (GRCh38)
Location 1:149669225-149669247 1:149669252-149669274
Sequence CCATTGTCCAGCTGTATAATGAA GAGTTCTCAGAGAAGAATACCGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 2, 3: 19, 4: 172} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!